amy1983 amy1983

16-11-2018
English

contestada

1. What is the main idea of the passage?
2. Give two key details from the text?
*
*

1 What is the main idea of the passage 2 Give two key details from the text class=

Respuesta :

TropicalFan TropicalFan

16-11-2018

The main idea is about Dolphins. The 2 key details are how they take care of there babies and about their teeth.

Answer Link

Otras preguntas

The analytical intelligence component of the triarchic theory of intelligence is demonstrated by the ability to ________. question 77 options:

What is the chief goal of science?

Which characteristic cannot be inherited?a) the ability to win a soccer gameb) length of fur in dogsc) shape of ears in pigsd) height of stem in a sunflower pla

Loren made 20 ounces of a snack mix that was 2/5 peanuts, 25% raisins, and 4 ounces of chocolate chips. The rest was granola. How many ounces of granola were in

The composite figure is made up of a triangular prism and a pyramid. The two solids have congruent bases.

Calculate the mean and median ages. a. The mean age is 38.28. The median age is 38. b. The mean age is 38. The median age is 38.28. c. The mean age is 37.08. Th

The end of the Paleozoic Era was signaled by

What is the equation of a line that passes through (7,8) and has a slope of -3? A. y= -3x +29 B.y=3x+13 C. y=1/3x-29 D.y=-1/3x-13

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

What is the best place to find the most recent developments in using lasers for surgical eye procedures?