Skullking
contestada

Replicate the following DNA segment

5’ agcgggatgagcgcatgtggcgcataactg3’

3’ tcgccctactcgcgtacaccgcgtattgac5’

Respuesta :

Replication of the following DNA segment will be the following:

5’ agcgggatgagcgcatgtggcgcataactg3’ 

3’ tcgccctactcgcgtacaccgcgtattgac5’

3’ tcgccctactcgcgtacaccgcgtattgac5’

5’ agcgggatgagcgcatgtggcgcataactg3’ 

When DNA replication begins, the two parent or main DNA strands are being separated. The first one is called the leading strand, which is replicated in a 3’ to 5’direction in a continuous manner. The other strand, which is known as the lagging strand, runs in the 5’ to 3’ direction. Once the DNA strands have been separated, they’ll be held apart and then new nucleotide partners will be bonded to each other thru hydrogen bonding. With the diagram above, remember the pairing rules: Adenine (A) partners with Thymine (T) and Cytosine (C) partners with Guanine (G).