teeledanielle85 teeledanielle85

18-10-2018
Mathematics

contestada

Puppies pizza uses 2/3 of an ounce of cheese on every 1/12 of a large pizza how many ounces of cheese are needed to make a whole pizza

Respuesta :

INeedAnswersPl0x INeedAnswersPl0x

18-10-2018

2/3 x 1/12= 2/36 = 1/18 hope this helps!

Answer Link

Otras preguntas

Help help!!!! please help

Farah is contemplating divorce because her husband is weak, clingy, and insecure. He demands her constant and undivided attention and is jealous of her other in

What is the value of x in the equation-5/8 x=-160

Joshua has written an argumentative essay on the value of teaching sculpture to primary school students. Which sentence would be the best concluding statement f

Is there ever a good enough reason to justify going to war?

Can someone please help me!

Solve 2 s 2x + 4 < 10 for x.

Triangle ABC is located at A (−2, 2), B (−2, 4), and C (0, 0). The triangle is then transformed using the rule (x+3, y− 2) to form the image A'B'C'. What are th

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra

What are the steps to developing a "working thesis statement"?