sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

BRIANILEST!!!!!The triangles below are similar Which similarity statement expresses the relationship between the two triangles?

what are the two main ways that minerals are classifiedA. chemical makeup and how they can be usedB. chemical makeup and Crystal lattice structureC. how they ca

Plz help no guessing

What is the area of the brain that undergoes considerable development during the adolescent years? corpus callosum myelin bridges prefrontal cortex cerebral

which speaker label is correct

What american scientist envisioned humans traveling to mars?

Which of the following terms describes the belief that the government should own the nation's major industries? A) socialism B) free enterprise C)

Part I: Word or Pdf Document, please save it to submit. Form sentences using the words given. Follow the model. Modelo: Yo / acostarse tarde Yo me acuesto tard

Please help me Yes I spelt it correctly again so help

Lydia made $56,750 last year. She paid $1200 in student loan interest and made a $3000 contribution to her IRA. On her federal tax return, she will claim $56,75